Table 1: Primers for PCR Analysis.


Gene Primer sequence Amplified fragment

GLIPR2 FW 5'- CCTGTGGGTGTATGTGCTTG -3' 157 pb
GLIPR2 RV 5'- CCCCAATCCAAATAATCGTG -3'

IL7R FW 5'- CTGAGGCTCCTTTTGACCTG -3' 159 pb*
IL7R RV 5'- TCACATGCGTCCATTTGTTT -3'

SREBF1 FW 5'- TGCATTTTCTGACACGCTTC -3' 171 pb*
SREBF1 RV 5'- CCAAGCTGTACAGGCTCTCC -3'

IL18 FW 5'- GGAATTGTCTCCCAGTGCAT -3' 177 pb*
IL18 RV 5'- ACTGGTTCAGCAGCCATCTT -3'

TGF β2 FW 5'- TGCTTTGGCTTTCTGGTTCT -3' 199 pb
TGF β2 RV 5'- TTTGTTTGTGGTGCAGTGGT -3'

MAP1B FW 5'- AATCGAGAAGACCAGCCTGA -3' 245 pb
MAP1B RV 5'- AATCCGTTGAGCGGTGTAAC -3'

ANLN FW 5'- ATGCAGTGTGGTGCACATTT -3' 195 pb
ANLN RV 5'- AACCCAAACACTTTGGCAAG -3'

HBG1 FW 5'- GCAAGAAGGTGCTGACTTCC -3' 176 pb*
HBG1 RV 5'- GAATTCTTTGCCGAAATGGA -3'

STARD4 FW 5'- GGCGAGTTGCTAAGAAAACG -3' 219 pb*
STARD4 RV 5'- TGTAACGCATCACACAGCAA -3'

AOC3 FW 5'- CAGGGGACACTGAACCTTGT -3' 233 pb
AOC3 RV 5'- CCTTTCCAGCTCAGCTATGG -3'

18S FW 5'- CGCGGTTCTATTTTGTTGGT -3' 219 pb
18S RV 5'-AGTCGGCATCGTTTATGGTC -3'

FW:FORWARD, RV:REVERSE,*Amplification of exon-exon union